Vesugen (Lys-Glu-Asp): Epigenetic MKI67 Promoter Binding, eNOS/SIRT1 Axis Activation, and Vascular Endothelial Regeneration in Aging and Atherosclerosis Research Models
1. Overview and Historical Context The concept of peptide bioregulation emerged from decades of research at the St. Petersburg Institute of Bioregulation and Gerontology, where Professor Vladimir Khavinson and colleagues systematically investigated shortchain peptides capable of modulating gene expression and protecting cellular function during aging. The foundational hypothesis holds that short peptides derived from or inspired by tissuespecific polypeptide complexes can restore the gene expression programs of aging cells to patterns characteristic of younger tissue, thereby slowing or partially reversing agerelated functional decline. Vesugen was developed within this framework as a vasculartargeted bioregulator. Its research lineage traces to polypeptide fractions originally extracted from cattle blood vessels, which demonstrated vasoprotective properties in early experimental models. The synthetic tripeptide LysGluAsp was designed to replicate the biological activity of those natural vasculartissue extracts in a reproducible, precisely characterized form suitable for controlled research. The compound is also referred to in the literature as KED (from the singleletter amino acid codes of its three constituent residues) and occasionally as Vezugen, an alternate transliteration from the Russian. What distinguished Vesugen from conventional peptide drugs from the outset was its proposed mechanism of action. Rather than binding to membrane receptors and initiating downstream signaling cascades in the conventional pharmacological sense, Vesugen was observed to enter cells and interact directly with nuclear DNA. This nuclear penetration and sequencespecific promoter binding placed Vesugen in a mechanistically unusual category — an epigenetic bioregulator — and provided a conceptual framework for understanding how a tripeptide of only three amino acids could exert tissuespecific effects on vascular aging. 2. Molecular Identity 2.1 Amino Acid Composition and Structural Features Vesugen is a tripeptide consisting of three amino acids arranged in the sequence lysine (Lys, K), glutamic acid (Glu, E), and aspartic acid (Asp, D). Its molecular formula is C₁₄H₂₅N₃O₇ with a molecular weight of approximately 351.4 g/mol, placing it well within the sub500 Da range associated with passive membrane permeability. This small size is not incidental to its mechanism: the ability to cross plasma membranes and reach the cell nucleus without active transport machinery is considered a prerequisite for its proposed epigenetic activity. The three residues contribute distinct physicochemical properties. Lysine's εamino group carries a positive charge at physiological pH, while the carboxylate side chains of glutamic acid and aspartic acid are negatively charged. This combination of cationic and anionic character across three adjacent residues creates a molecule capable of forming hydrogen bonds with nucleic acid structures, particularly through interactions with the minor groove of the DNA double helix. Khavinson's research group has proposed that this charge distribution is the structural basis for Vesugen's sequencespecific DNA promoter interactions. As a linear tripeptide without protective modifications such as PEGylation or cyclization, Vesugen is susceptible to degradation by plasma and tissue peptidases. Detailed pharmacokinetic parameters including halflife, volume of distribution, and absolute oral bioavailability have not been published in the available Englishlanguage literature. 3. Mechanistic Rationale 3.1 MKI67 Promoter Binding and Epigenetic Ki67 Upregulation The most structurally specific and mechanistically distinctive action attributed to Vesugen is its direct binding to the promoter region of the MKI67 gene. Studies conducted by Khavinson and colleagues using molecular docking methods demonstrated that the KED tripeptide interacts with the MKI67 core promoter sequence 5'agcctcaaccatcaggaaaacaagagt3' at positions 14 to +12 base pairs relative to the transcriptional initiation site, through the CATC sequence (ENSG00000148773). The binding involves minor groove hydrogen bond interactions between the peptide's charged residues and specific base pairs of the DNA double helix. "Short peptides vesugen and D7 stimulated the synthesis of the proliferationassociated protein Ki67, the expression of which decreased during aging in tissuespecific cell cultures obtained from young and old animals and in dissociated vascular endothelial cell cultures... the vasoprotective effect of vesugen, which was previously revealed in elder people, can be manifested through epigenetic regulation of the Ki67 gene expression." — Khavinson VKh et al., Advances in Gerontology, 2015 MKI67 encodes the Ki67 protein, a nuclear protein that serves as a wellestablished marker of active cell proliferation. Ki67 expression declines progressively with aging in vascular endothelial cells, contributing to reduced endothelial renewal capacity. In the aging
For research use only. Not for human consumption.